Our trustworthy “health experts and fact checkers” have been warning us for over a year that mRNA vaccines, such as those made by Pfizer and Moderna, do not incorporate into human cellular DNA.
However, a recent study published in Current Issues in Molecular Biology revealed that health experts and fact checkers were inaccurate.
mRNA vaccinations DO incorporate themselves into human cellular DNA, according to lab experiments. Vaccines, in essence, alter your DNA for the rest of your life.
What that signifies is that lab experiments have shown that mRNA vaccines DO integrate into human cellular DNA. This means that even a single dose of Pfizer vaccine permanently alters the DNA of afflicted cells.
The mainstream media and fact checkers have made it their mission to persuade us the exact opposite:
However, the bombshell article from Current Issues of Molecular Biology suggests they have been spreading disinformation all along.
A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.
IgorChudov reports:
What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.
However, the bombshell article from Current Issues of Molecular Biology shows the opposite.
What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.
It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).
What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.
This process is called “transcription”.
For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.
To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.
Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.
After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.
The genetic code that they picked up is:
CGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT
GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
TCGACGAGGACGATTCTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACACATGATGAC
TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA
Anyone wants to run BLAST on it?
Simplified
As I explained in response to a questioner:
Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.
Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.
Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.
Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.
Please repost this article far and wide due to its big implication for our public health.
EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?
Is this the bottom line?: fact checkers falsely claimed MRNA induced cells would not produce daughter cells with the mutation (therefore MRNA affected cells would depopulate through attrition). Actually all subsequent generations WILL carry the mutation.
It turns out that everyone in government from fbi/doj/to cdc and other department just lie to line their pockets. Fauci has lied from the beginning and was part and parcel one of the inventors of this pandemic and is anything done to these criminals – nope. seems having your hand out to be rewarded for betraying america is the common thing to do. Seems destroying America is the goal.
It’s Multinational conspiracy genocide treason.
I only see a new LAW and OATH as able to address these new national security threats, and I see it as something the Founding Fathers could not have foreseen. I would change it like so OLD OATH+I swear to protect against commie marxist lenonist socialist globalist terrorist maoist pedoist and identity frauds+SO HELP ME GOD
After this the agencies that MUST BE GUTTED/deactivated/”BRAC’d.” I suggest
deactivate/secure devices/BRAC them
fbi, doj, ses, cia, ig, jttf, jtf, dtra, fisa, nsa, atf, State Dept, NG that surrounded the Whitehouse, NationalGuard Californa(theywere with nazis in ukraine), State Dept, FCC, FDA.. CDC, NIH, HHS, DHS, WHO, UN/NATO/DYNCORP, iia, dynology, CLEARFORCE, shadownet, OSHA. I know that seems like a lot, but I watched each commit terrorist or treasonous acts against innocent Americans.
The people that did BACKGROUND CHECKS ON BIDEN allowing them on the BALLOT. Those got to go too. We wouldn’t have the problems we have if they were not on the ballot in the first place.
Well, the truth is coming out and it was much sooner than I thought it would be. I thought it would take forever to begin to come to the surface. I hope this leads to arrest for many people at Pfizer, the FDA, CDC and the leaders of this whole hoax namely Bill Gates and Anthony Faulci.
Don’t hold your breath! Big Pharma has been killing people for years and they always get nothing more than a banned drug or a slap on the wrist. FDA and Big Pharma are in bed together and they go through ALL the positions! Total sell-out murderers!
The Big Banks set aside funds knowing there would be repercussions from their un-savory and predatory practices during the 2008 crash.
Phizer is prepared for the fallout.
And a federal Judge ordered FDA to release ALL of Pfizer data by August (55,000 pages per mo), when we should know the rest of the horrific story.
I have never trusted vaccines, drugs or the FDA ! about 25 years ago the FDA and all the corp’s who deal with the FDA went to Congress to have a law changed. It use to be that us tax payers paid millions to the FDA, but after the law was changed we only pay a small amount to the FDA, but who pays the rest ? The corp’s who the FDA control. This is why you have seen more vaccines that ever before, like vaccines for babies who are not born yet. It’s all about money for the FDA. I suggest the FDA go private and also all the other government groups.
Just do a little research on the “FDA approval” of aspartame in 1980 to see how dangerous and above the law Big Pharma is!
Now that we know this much, we need to know how many of the shots were “hot”, and where those went. This is shaping up to be a far-reaching crime. In a just environment, many would go to the gallows for it, particularly those in the sciences and in gov’t who KNEW what this thing is.
If this is true then the people of the world must finally revolt and execute everyone involved from the CEOS on down and esp. the politicians, judges etc and no exceptions, Lady Razor must be used NOW